standard scramble sequence (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
90
Structured Review
OriGene
standard scramble sequence
Standard Scramble Sequence, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/standard+scramble+sequence/scrambled+target+sequence/pmc07879711-537-24-20
Average 90 stars, based on 1 article reviews
Standard Scramble Sequence, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/standard+scramble+sequence/scrambled+target+sequence/pmc07879711-537-24-20
Average 90 stars, based on 1 article reviews
standard scramble sequence - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Rapid 3D Enhanced Resolution Microscopy Reveals Diversity in Dendritic Spinule Dynamics, Regulation, and Function Article Snippet: .. To generate the pAAV-shKal-7 GFP plasmid, the Kal-7 shRNA sequence GCAGTACAATCCTGGCCATGT ( Xie et al., 2010 ) was ordered from OriGene, along with a shRNA:Article Title: Rapid 3D Enhanced Resolution Microscopy Reveals Diversity in Dendritic Spinule Dynamics, Regulation, and Function Article Snippet: .. To generate the pAAV-shKal-7 GFP plasmid, the Kal-7 shRNA sequence GCAGTACAATCCTGGCCATGT ( Xie et al., 2010 ) was ordered from OriGene, along with a Sequencing:Article Title: Rapid 3D Enhanced Resolution Microscopy Reveals Diversity in Dendritic Spinule Dynamics, Regulation, and Function Article Snippet: .. To generate the pAAV-shKal-7 GFP plasmid, the Kal-7 shRNA sequence GCAGTACAATCCTGGCCATGT ( Xie et al., 2010 ) was ordered from OriGene, along with a Control:Article Title: Rapid 3D Enhanced Resolution Microscopy Reveals Diversity in Dendritic Spinule Dynamics, Regulation, and Function Article Snippet: .. To generate the pAAV-shKal-7 GFP plasmid, the Kal-7 shRNA sequence GCAGTACAATCCTGGCCATGT ( Xie et al., 2010 ) was ordered from OriGene, along with a |